20 votes

Reverse engineering the source code of the BioNTech/Pfizer SARS-CoV-2 vaccine

4 comments

  1. [3]
    petrichor
    Link
    Bumping this. It's a great article that didn't garner much discussion when it was first posted. Both Pfizer and Moderna mRNA sequences are now publicly available (discussed on HN). I'm surprised...

    Bumping this. It's a great article that didn't garner much discussion when it was first posted.

    Both Pfizer and Moderna mRNA sequences are now publicly available (discussed on HN). I'm surprised by how short they both are - around 4500 characters each.

    Pfizer mRNA sequence

    GAGAATAAACTAGTATTCTTCTGGTCCCCACAGACTCAGAGAGAACCCGCCACCATGTTCGTGTTCCTGGTGCTGCTGCCTCTGGTGTCCAGCCAGTGTGTGAACCTGACCACCAGAACACAGCTGCCTCCAGCCTACACCAACAGCTTTACCAGAGGCGTGTACTACCCCGACAAGGTGTTCAGATCCAGCGTGCTGCACTCTACCCAGGACCTGTTCCTGCCTTTCTTCAGCAACGTGACCTGGTTCCACGCCATCCACGTGTCCGGCACCAATGGCACCAAGAGATTCGACAACCCCGTGCTGCCCTTCAACGACGGGGTGTACTTTGCCAGCACCGAGAAGTCCAACATCATCAGAGGCTGGATCTTCGGCACCACACTGGACAGCAAGACCCAGAGCCTGCTGATCGTGAACAACGCCACCAACGTGGTCATCAAAGTGTGCGAGTTCCAGTTCTGCAACGACCCCTTCCTGGGCGTCTACTACCACAAGAACAACAAGAGCTGGATGGAAAGCGAGTTCCGGGTGTACAGCAGCGCCAACAACTGCACCTTCGAGTACGTGTCCCAGCCTTTCCTGATGGACCTGGAAGGCAAGCAGGGCAACTTCAAGAACCTGCGCGAGTTCGTGTTTAAGAACATCGACGGCTACTTCAAGATCTACAGCAAGCACACCCCTATCAACCTCGTGCGGGATCTGCCTCAGGGCTTCTCTGCTCTGGAACCCCTGGTGGATCTGCCCATCGGCATCAACATCACCCGGTTTCAGACACTGCTGGCCCTGCACAGAAGCTACCTGACACCTGGCGATAGCAGCAGCGGATGGACAGCTGGTGCCGCCGCTTACTATGTGGGCTACCTGCAGCCTAGAACCTTCCTGCTGAAGTACAACGAGAACGGCACCATCACCGACGCCGTGGATTGTGCTCTGGATCCTCTGAGCGAGACAAAGTGCACCCTGAAGTCCTTCACCGTGGAAAAGGGCATCTACCAGACCAGCAACTTCCGGGTGCAGCCCACCGAATCCATCGTGCGGTTCCCCAATATCACCAATCTGTGCCCCTTCGGCGAGGTGTTCAATGCCACCAGATTCGCCTCTGTGTACGCCTGGAACCGGAAGCGGATCAGCAATTGCGTGGCCGACTACTCCGTGCTGTACAACTCCGCCAGCTTCAGCACCTTCAAGTGCTACGGCGTGTCCCCTACCAAGCTGAACGACCTGTGCTTCACAAACGTGTACGCCGACAGCTTCGTGATCCGGGGAGATGAAGTGCGGCAGATTGCCCCTGGACAGACAGGCAAGATCGCCGACTACAACTACAAGCTGCCCGACGACTTCACCGGCTGTGTGATTGCCTGGAACAGCAACAACCTGGACTCCAAAGTCGGCGGCAACTACAATTACCTGTACCGGCTGTTCCGGAAGTCCAATCTGAAGCCCTTCGAGCGGGACATCTCCACCGAGATCTATCAGGCCGGCAGCACCCCTTGTAACGGCGTGGAAGGCTTCAACTGCTACTTCCCACTGCAGTCCTACGGCTTTCAGCCCACAAATGGCGTGGGCTATCAGCCCTACAGAGTGGTGGTGCTGAGCTTCGAACTGCTGCATGCCCCTGCCACAGTGTGCGGCCCTAAGAAAAGCACCAATCTCGTGAAGAACAAATGCGTGAACTTCAACTTCAACGGCCTGACCGGCACCGGCGTGCTGACAGAGAGCAACAAGAAGTTCCTGCCATTCCAGCAGTTTGGCCGGGATATCGCCGATACCACAGACGCCGTTAGAGATCCCCAGACACTGGAAATCCTGGACATCACCCCTTGCAGCTTCGGCGGAGTGTCTGTGATCACCCCTGGCACCAACACCAGCAATCAGGTGGCAGTGCTGTACCAGGACGTGAACTGTACCGAAGTGCCCGTGGCCATTCACGCCGATCAGCTGACACCTACATGGCGGGTGTACTCCACCGGCAGCAATGTGTTTCAGACCAGAGCCGGCTGTCTGATCGGAGCCGAGCACGTGAACAATAGCTACGAGTGCGACATCCCCATCGGCGCTGGAATCTGCGCCAGCTACCAGACACAGACAAACAGCCCTCGGAGAGCCAGAAGCGTGGCCAGCCAGAGCATCATTGCCTACACAATGTCTCTGGGCGCCGAGAACAGCGTGGCCTACTCCAACAACTCTATCGCTATCCCCACCAACTTCACCATCAGCGTGACCACAGAGATCCTGCCTGTGTCCATGACCAAGACCAGCGTGGACTGCACCATGTACATCTGCGGCGATTCCACCGAGTGCTCCAACCTGCTGCTGCAGTACGGCAGCTTCTGCACCCAGCTGAATAGAGCCCTGACAGGGATCGCCGTGGAACAGGACAAGAACACCCAAGAGGTGTTCGCCCAAGTGAAGCAGATCTACAAGACCCCTCCTATCAAGGACTTCGGCGGCTTCAATTTCAGCCAGATTCTGCCCGATCCTAGCAAGCCCAGCAAGCGGAGCTTCATCGAGGACCTGCTGTTCAACAAAGTGACACTGGCCGACGCCGGCTTCATCAAGCAGTATGGCGATTGTCTGGGCGACATTGCCGCCAGGGATCTGATTTGCGCCCAGAAGTTTAACGGACTGACAGTGCTGCCTCCTCTGCTGACCGATGAGATGATCGCCCAGTACACATCTGCCCTGCTGGCCGGCACAATCACAAGCGGCTGGACATTTGGAGCAGGCGCCGCTCTGCAGATCCCCTTTGCTATGCAGATGGCCTACCGGTTCAACGGCATCGGAGTGACCCAGAATGTGCTGTACGAGAACCAGAAGCTGATCGCCAACCAGTTCAACAGCGCCATCGGCAAGATCCAGGACAGCCTGAGCAGCACAGCAAGCGCCCTGGGAAAGCTGCAGGACGTGGTCAACCAGAATGCCCAGGCACTGAACACCCTGGTCAAGCAGCTGTCCTCCAACTTCGGCGCCATCAGCTCTGTGCTGAACGATATCCTGAGCAGACTGGACCCTCCTGAGGCCGAGGTGCAGATCGACAGACTGATCACAGGCAGACTGCAGAGCCTCCAGACATACGTGACCCAGCAGCTGATCAGAGCCGCCGAGATTAGAGCCTCTGCCAATCTGGCCGCCACCAAGATGTCTGAGTGTGTGCTGGGCCAGAGCAAGAGAGTGGACTTTTGCGGCAAGGGCTACCACCTGATGAGCTTCCCTCAGTCTGCCCCTCACGGCGTGGTGTTTCTGCACGTGACATATGTGCCCGCTCAAGAGAAGAATTTCACCACCGCTCCAGCCATCTGCCACGACGGCAAAGCCCACTTTCCTAGAGAAGGCGTGTTCGTGTCCAACGGCACCCATTGGTTCGTGACACAGCGGAACTTCTACGAGCCCCAGATCATCACCACCGACAACACCTTCGTGTCTGGCAACTGCGACGTCGTGATCGGCATTGTGAACAATACCGTGTACGACCCTCTGCAGCCCGAGCTGGACAGCTTCAAAGAGGAACTGGACAAGTACTTTAAGAACCACACAAGCCCCGACGTGGACCTGGGCGATATCAGCGGAATCAATGCCAGCGTCGTGAACATCCAGAAAGAGATCGACCGGCTGAACGAGGTGGCCAAGAATCTGAACGAGAGCCTGATCGACCTGCAAGAACTGGGGAAGTACGAGCAGTACATCAAGTGGCCCTGGTACATCTGGCTGGGCTTTATCGCCGGACTGATTGCCATCGTGATGGTCACAATCATGCTGTGTTGCATGACCAGCTGCTGTAGCTGCCTGAAGGGCTGTTGTAGCTGTGGCAGCTGCTGCAAGTTCGACGAGGACGATTCTGAGCCCGTGCTGAAGGGCGTGAAACTGCACTACACATGATGACTCGAGCTGGTACTGCATGCACGCAATGCTAGCTGCCCCTTTCCCGTCCTGGGTACCCCGAGTCTCCCCCGACCTCGGGTCCCAGGTATGCTCCCACCTCCACCTGCCCCACTCACCACCTCTGCTAGTTCCAGACACCTCCCAAGCACGCAGCAATGCAGCTCAAAACGCTTAGCCTAGCCACACCCCCACGGGAAACAGCAGTGATTAACCTTTAGCAATAAACGAAAGTTTAACTAAGCTATACTAACCCCAGGGTTGGTCAATTTCGTGCCAGCCACACCCTGGAGCTAGCA

    Moderna mRNA sequence

    GGGAAATAAGAGAGAAAAGAAGAGTAAGAAGAAATATAAGACCCCGGCGCCGCCACCATGTTCGTGTTCCTGGTGCTGCTGCCCCTGGTGAGCAGCCAGTGCGTGAACCTGACCACCCGGACCCAGCTGCCACCAGCCTACACCAACAGCTTCACCCGGGGCGTCTACTACCCCGACAAGGTGTTCCGGAGCAGCGTCCTGCACAGCACCCAGGACCTGTTCCTGCCCTTCTTCAGCAACGTGACCTGGTTCCACGCCATCCACGTGAGCGGCACCAACGGCACCAAGCGGTTCGACAACCCCGTGCTGCCCTTCAACGACGGCGTGTACTTCGCCAGCACCGAGAAGAGCAACATCATCCGGGGCTGGATCTTCGGCACCACCCTGGACAGCAAGACCCAGAGCCTGCTGATCGTGAATAACGCCACCAACGTGGTGATCAAGGTGTGCGAGTTCCAGTTCTGCAACGACCCCTTCCTGGGCGTGTACTACCACAAGAACAACAAGAGCTGGATGGAGAGCGAGTTCCGGGTGTACAGCAGCGCCAACAACTGCACCTTCGAGTACGTGAGCCAGCCCTTCCTGATGGACCTGGAGGGCAAGCAGGGCAACTTCAAGAACCTGCGGGAGTTCGTGTTCAAGAACATCGACGGCTACTTCAAGATCTACAGCAAGCACACCCCAATCAACCTGGTGCGGGATCTGCCCCAGGGCTTCTCAGCCCTGGAGCCCCTGGTGGACCTGCCCATCGGCATCAACATCACCCGGTTCCAGACCCTGCTGGCCCTGCACCGGAGCTACCTGACCCCAGGCGACAGCAGCAGCGGGTGGACAGCAGGCGCGGCTGCTTACTACGTGGGCTACCTGCAGCCCCGGACCTTCCTGCTGAAGTACAACGAGAACGGCACCATCACCGACGCCGTGGACTGCGCCCTGGACCCTCTGAGCGAGACCAAGTGCACCCTGAAGAGCTTCACCGTGGAGAAGGGCATCTACCAGACCAGCAACTTCCGGGTGCAGCCCACCGAGAGCATCGTGCGGTTCCCCAACATCACCAACCTGTGCCCCTTCGGCGAGGTGTTCAACGCCACCCGGTTCGCCAGCGTGTACGCCTGGAACCGGAAGCGGATCAGCAACTGCGTGGCCGACTACAGCGTGCTGTACAACAGCGCCAGCTTCAGCACCTTCAAGTGCTACGGCGTGAGCCCCACCAAGCTGAACGACCTGTGCTTCACCAACGTGTACGCCGACAGCTTCGTGATCCGTGGCGACGAGGTGCGGCAGATCGCACCCGGCCAGACAGGCAAGATCGCCGACTACAACTACAAGCTGCCCGACGACTTCACCGGCTGCGTGATCGCCTGGAACAGCAACAACCTCGACAGCAAGGTGGGCGGCAACTACAACTACCTGTACCGGCTGTTCCGGAAGAGCAACCTGAAGCCCTTCGAGCGGGACATCAGCACCGAGATCTACCAAGCCGGCTCCACCCCTTGCAACGGCGTGGAGGGCTTCAACTGCTACTTCCCTCTGCAGAGCTACGGCTTCCAGCCCACCAACGGCGTGGGCTACCAGCCCTACCGGGTGGTGGTGCTGAGCTTCGAGCTGCTGCACGCCCCAGCCACCGTGTGTGGCCCCAAGAAGAGCACCAACCTGGTGAAGAACAAGTGCGTGAACTTCAACTTCAACGGCCTTACCGGCACCGGCGTGCTGACCGAGAGCAACAAGAAATTCCTGCCCTTTCAGCAGTTCGGCCGGGACATCGCCGACACCACCGACGCTGTGCGGGATCCCCAGACCCTGGAGATCCTGGACATCACCCCTTGCAGCTTCGGCGGCGTGAGCGTGATCACCCCAGGCACCAACACCAGCAACCAGGTGGCCGTGCTGTACCAGGACGTGAACTGCACCGAGGTGCCCGTGGCCATCCACGCCGACCAGCTGACACCCACCTGGCGGGTCTACAGCACCGGCAGCAACGTGTTCCAGACCCGGGCCGGTTGCCTGATCGGCGCCGAGCACGTGAACAACAGCTACGAGTGCGACATCCCCATCGGCGCCGGCATCTGTGCCAGCTACCAGACCCAGACCAATTCACCCCGGAGGGCAAGGAGCGTGGCCAGCCAGAGCATCATCGCCTACACCATGAGCCTGGGCGCCGAGAACAGCGTGGCCTACAGCAACAACAGCATCGCCATCCCCACCAACTTCACCATCAGCGTGACCACCGAGATTCTGCCCGTGAGCATGACCAAGACCAGCGTGGACTGCACCATGTACATCTGCGGCGACAGCACCGAGTGCAGCAACCTGCTGCTGCAGTACGGCAGCTTCTGCACCCAGCTGAACCGGGCCCTGACCGGCATCGCCGTGGAGCAGGACAAGAACACCCAGGAGGTGTTCGCCCAGGTGAAGCAGATCTACAAGACCCCTCCCATCAAGGACTTCGGCGGCTTCAACTTCAGCCAGATCCTGCCCGACCCCAGCAAGCCCAGCAAGCGGAGCTTCATCGAGGACCTGCTGTTCAACAAGGTGACCCTAGCCGACGCCGGCTTCATCAAGCAGTACGGCGACTGCCTCGGCGACATAGCCGCCCGGGACCTGATCTGCGCCCAGAAGTTCAACGGCCTGACCGTGCTGCCTCCCCTGCTGACCGACGAGATGATCGCCCAGTACACCAGCGCCCTGTTAGCCGGAACCATCACCAGCGGCTGGACTTTCGGCGCTGGAGCCGCTCTGCAGATCCCCTTCGCCATGCAGATGGCCTACCGGTTCAACGGCATCGGCGTGACCCAGAACGTGCTGTACGAGAACCAGAAGCTGATCGCCAACCAGTTCAACAGCGCCATCGGCAAGATCCAGGACAGCCTGAGCAGCACCGCTAGCGCCCTGGGCAAGCTGCAGGACGTGGTGAACCAGAACGCCCAGGCCCTGAACACCCTGGTGAAGCAGCTGAGCAGCAACTTCGGCGCCATCAGCAGCGTGCTGAACGACATCCTGAGCCGGCTGGACCCTCCCGAGGCCGAGGTGCAGATCGACCGGCTGATCACTGGCCGGCTGCAGAGCCTGCAGACCTACGTGACCCAGCAGCTGATCCGGGCCGCCGAGATTCGGGCCAGCGCCAACCTGGCCGCCACCAAGATGAGCGAGTGCGTGCTGGGCCAGAGCAAGCGGGTGGACTTCTGCGGCAAGGGCTACCACCTGATGAGCTTTCCCCAGAGCGCACCCCACGGAGTGGTGTTCCTGCACGTGACCTACGTGCCCGCCCAGGAGAAGAACTTCACCACCGCCCCAGCCATCTGCCACGACGGCAAGGCCCACTTTCCCCGGGAGGGCGTGTTCGTGAGCAACGGCACCCACTGGTTCGTGACCCAGCGGAACTTCTACGAGCCCCAGATCATCACCACCGACAACACCTTCGTGAGCGGCAACTGCGACGTGGTGATCGGCATCGTGAACAACACCGTGTACGATCCCCTGCAGCCCGAGCTGGACAGCTTCAAGGAGGAGCTGGACAAGTACTTCAAGAATCACACCAGCCCCGACGTGGACCTGGGCGACATCAGCGGCATCAACGCCAGCGTGGTGAACATCCAGAAGGAGATCGATCGGCTGAACGAGGTGGCCAAGAACCTGAACGAGAGCCTGATCGACCTGCAGGAGCTGGGCAAGTACGAGCAGTACATCAAGTGGCCCTGGTACATCTGGCTGGGCTTCATCGCCGGCCTGATCGCCATCGTGATGGTGACCATCATGCTGTGCTGCATGACCAGCTGCTGCAGCTGCCTGAAGGGCTGTTGCAGCTGCGGCAGCTGCTGCAAGTTCGACGAGGACGACAGCGAGCCCGTGCTGAAGGGCGTGAAGCTGCACTACACCTGATAATAGGCTGGAGCCTCGGTGGCCTAGCTTCTTGCCCCTTGGGCCTCCCCCCAGCCCCTCCTCCCCTTCCTGCACCCGTACCCCCGTGGTCTTTGAATAAAGTCTGAGTGGGCGGCAAAAAAAAA

    7 votes
    1. nothis
      Link Parent
      At 2 bits of data per letter (there's only 4 nucleobases, right?), that's roughly a kilobyte of data. It's crazy what that can achieve.

      around 4500 characters each.

      At 2 bits of data per letter (there's only 4 nucleobases, right?), that's roughly a kilobyte of data. It's crazy what that can achieve.

      2 votes
    2. eladnarra
      Link Parent
      Thank you for bumping this! I missed it when it was first posted, and it's a great article. As someone who studied biology in undergrad and is now switching to web development, it was pretty fun...

      Thank you for bumping this! I missed it when it was first posted, and it's a great article.

      As someone who studied biology in undergrad and is now switching to web development, it was pretty fun to see it explained this way.

      Some lingo here. RNA molecules can only be read in one direction. Confusingly, the part where the reading begins is called the 5’ or ‘five-prime’. The reading stops at the 3’ or three-prime end.

      For anyone who's interested in knowing why it's "five prime" and "three prime," it has to do with the numbering of the carbons in the sugar ring. Directionality on Wikipedia.

      1 vote
  2. Shneebs
    Link
    Extremely interesting and very well written that I was able to understand pretty much everything.

    Extremely interesting and very well written that I was able to understand pretty much everything.

    3 votes